
Member Login
Current position:Products>New products

miR_Primers for qPCR

TIANGEN Biotech(Beijing)Co.,Ltd.
  • Species
  • miRBase ID
  • Mature sequence
Tiangen Cat Number Species Product Name miRBase ID miRBase Accession # Mature sequence
CD202-0159 Mouse mmu-miR-33-5p qPCR Primer mmu-miR-33-5p MIMAT0000667 GUGCAUUGUAGUUGCAUUGCA
CD202-0158 Mouse mmu-miR-33-3p qPCR Primer mmu-miR-33-3p MIMAT0004666 CAAUGUUUCCACAGUGCAUCAC
CD202-0157 Mouse mmu-miR-339-5p qPCR Primer mmu-miR-339-5p MIMAT0000584 UCCCUGUCCUCCAGGAGCUCACG
CD202-0156 Mouse mmu-miR-331-3p qPCR Primer mmu-miR-331-3p MIMAT0000571 GCCCCUGGGCCUAUCCUAGAA
CD202-0155 Mouse mmu-miR-330-5p qPCR Primer mmu-miR-330-5p MIMAT0004642 UCUCUGGGCCUGUGUCUUAGGC
CD202-0154 Mouse mmu-miR-32-3p qPCR Primer mmu-miR-32-3p MIMAT0017050 CAAUUUAGUGUGUGUGAUAUUU
CD202-0153 Mouse mmu-miR-323-5p qPCR Primer mmu-miR-323-5p MIMAT0004638 AGGUGGUCCGUGGCGCGUUCGC
CD202-0152 Mouse mmu-miR-301a-5p qPCR Primer mmu-miR-301a-5p MIMAT0017008 GCUCUGACUUUAUUGCACUACU
CD202-0151 Mouse mmu-miR-29b-1-5p qPCR Primer mmu-miR-29b-1-5p MIMAT0004523 GCUGGUUUCAUAUGGUGGUUUAGA
CD202-0150 Mouse mmu-miR-29a-5p qPCR Primer mmu-miR-29a-5p MIMAT0004631 ACUGAUUUCUUUUGGUGUUCAG
CD202-0149 Mouse mmu-miR-296-3p qPCR Primer mmu-miR-296-3p MIMAT0004576 GAGGGUUGGGUGGAGGCUCUCC
CD202-0148 Mouse mmu-miR-27b-5p qPCR Primer mmu-miR-27b-5p MIMAT0004522 AGAGCUUAGCUGAUUGGUGAAC
CD202-0147 Mouse mmu-miR-27a-5p qPCR Primer mmu-miR-27a-5p MIMAT0004633 AGGGCUUAGCUGCUUGUGAGCA
CD202-0146 Mouse mmu-miR-25-3p qPCR Primer mmu-miR-25-3p MIMAT0000652 CAUUGCACUUGUCUCGGUCUGA
CD202-0145 Mouse mmu-miR-23a-5p qPCR Primer mmu-miR-23a-5p MIMAT0017019 GGGGUUCCUGGGGAUGGGAUUU
CD202-0144 Mouse mmu-miR-22-3p qPCR Primer mmu-miR-22-3p MIMAT0000531 AAGCUGCCAGUUGAAGAACUGU
CD202-0143 Mouse mmu-miR-219a-5p qPCR Primer mmu-miR-219a-5p MIMAT0000664 UGAUUGUCCAAACGCAAUUCU
CD202-0142 Mouse mmu-miR-219a-2-3p qPCR Primer mmu-miR-219a-2-3p MIMAT0022841 AGAAUUGUGGCUGGACAUCUGU
CD202-0141 Mouse mmu-miR-218-5p qPCR Primer mmu-miR-218-5p MIMAT0000663 UUGUGCUUGAUCUAACCAUGU
CD202-0140 Mouse mmu-miR-218-2-3p qPCR Primer mmu-miR-218-2-3p MIMAT0005444 CAUGGUUCUGUCAAGCACCGCG
ICP No.09014905  Copyright © TIANGEN Biotech(Beijing)Co.,Ltd.
